<?xml version="1.0"?>
<feed xmlns="http://www.w3.org/2005/Atom" xml:lang="ru">
	<id>https://wiki.mininuniver.ru/index.php?action=history&amp;feed=atom&amp;title=~Delete_1983</id>
	<title>~Delete 1983 - История изменений</title>
	<link rel="self" type="application/atom+xml" href="https://wiki.mininuniver.ru/index.php?action=history&amp;feed=atom&amp;title=~Delete_1983"/>
	<link rel="alternate" type="text/html" href="https://wiki.mininuniver.ru/index.php?title=~Delete_1983&amp;action=history"/>
	<updated>2026-07-03T02:10:43Z</updated>
	<subtitle>История изменений этой страницы в вики</subtitle>
	<generator>MediaWiki 1.32.0</generator>
	<entry>
		<id>https://wiki.mininuniver.ru/index.php?title=~Delete_1983&amp;diff=379470&amp;oldid=prev</id>
		<title>Moderator: Moderator переименовал страницу Akt has been the issue of powerful examine в ~Delete 1983: Spam</title>
		<link rel="alternate" type="text/html" href="https://wiki.mininuniver.ru/index.php?title=~Delete_1983&amp;diff=379470&amp;oldid=prev"/>
		<updated>2025-12-18T03:07:28Z</updated>

		<summary type="html">&lt;p&gt;Moderator переименовал страницу &lt;a href=&quot;/index.php/Akt_has_been_the_issue_of_powerful_examine&quot; class=&quot;mw-redirect&quot; title=&quot;Akt has been the issue of powerful examine&quot;&gt;Akt has been the issue of powerful examine&lt;/a&gt; в &lt;a href=&quot;/index.php/~Delete_1983&quot; title=&quot;~Delete 1983&quot;&gt;~Delete 1983&lt;/a&gt;: Spam&lt;/p&gt;
&lt;table class=&quot;diff diff-contentalign-left&quot; data-mw=&quot;interface&quot;&gt;
				&lt;tr class=&quot;diff-title&quot; lang=&quot;ru&quot;&gt;
				&lt;td colspan=&quot;1&quot; style=&quot;background-color: #fff; color: #222; text-align: center;&quot;&gt;← Предыдущая&lt;/td&gt;
				&lt;td colspan=&quot;1&quot; style=&quot;background-color: #fff; color: #222; text-align: center;&quot;&gt;Версия 03:07, 18 декабря 2025&lt;/td&gt;
				&lt;/tr&gt;&lt;tr&gt;&lt;td colspan=&quot;2&quot; class=&quot;diff-notice&quot; lang=&quot;ru&quot;&gt;&lt;div class=&quot;mw-diff-empty&quot;&gt;(нет различий)&lt;/div&gt;
&lt;/td&gt;&lt;/tr&gt;&lt;/table&gt;</summary>
		<author><name>Moderator</name></author>
		
	</entry>
	<entry>
		<id>https://wiki.mininuniver.ru/index.php?title=~Delete_1983&amp;diff=379469&amp;oldid=prev</id>
		<title>Moderator: Spam cleanup</title>
		<link rel="alternate" type="text/html" href="https://wiki.mininuniver.ru/index.php?title=~Delete_1983&amp;diff=379469&amp;oldid=prev"/>
		<updated>2025-12-18T03:07:27Z</updated>

		<summary type="html">&lt;p&gt;Spam cleanup&lt;/p&gt;
&lt;table class=&quot;diff diff-contentalign-left&quot; data-mw=&quot;interface&quot;&gt;
				&lt;col class=&quot;diff-marker&quot; /&gt;
				&lt;col class=&quot;diff-content&quot; /&gt;
				&lt;col class=&quot;diff-marker&quot; /&gt;
				&lt;col class=&quot;diff-content&quot; /&gt;
				&lt;tr class=&quot;diff-title&quot; lang=&quot;ru&quot;&gt;
				&lt;td colspan=&quot;2&quot; style=&quot;background-color: #fff; color: #222; text-align: center;&quot;&gt;← Предыдущая&lt;/td&gt;
				&lt;td colspan=&quot;2&quot; style=&quot;background-color: #fff; color: #222; text-align: center;&quot;&gt;Версия 03:07, 18 декабря 2025&lt;/td&gt;
				&lt;/tr&gt;&lt;tr&gt;&lt;td colspan=&quot;2&quot; class=&quot;diff-lineno&quot; id=&quot;mw-diff-left-l1&quot; &gt;Строка 1:&lt;/td&gt;
&lt;td colspan=&quot;2&quot; class=&quot;diff-lineno&quot;&gt;Строка 1:&lt;/td&gt;&lt;/tr&gt;
&lt;tr&gt;&lt;td class='diff-marker'&gt;−&lt;/td&gt;&lt;td style=&quot;color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;&quot;&gt;&lt;div&gt;&lt;del class=&quot;diffchange diffchange-inline&quot;&gt;We present that overall MK-1775 protein and mRNA was in excess of-expressed [http://www.selleckchem.com/products/MK-1775.html MK-1775], [http://www.selleckchem.com/products/dabrafenib-gsk2118436.html order Dabrafenib  find out here], [http://www.selleckchem.com/products/Enzastaurin.html purchase Enzastaurin selleckchem]  in a bulk of human breast cancers and that 21% of tumors experienced five or much more copies of the gene encoding MK-1775, PDPK1. In human mammary cells, MK-1775 improved the potential of upstream lesions to signal to AKT, stimulate mobile growth and migration, and rendered cells more resistant to MK-1775 and PI3K inhibition.&lt;/del&gt;&lt;/div&gt;&lt;/td&gt;&lt;td class='diff-marker'&gt;+&lt;/td&gt;&lt;td style=&quot;color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;&quot;&gt;&lt;div&gt;&lt;ins class=&quot;diffchange diffchange-inline&quot;&gt;Content removed&lt;/ins&gt;&lt;/div&gt;&lt;/td&gt;&lt;/tr&gt;
&lt;tr&gt;&lt;td class='diff-marker'&gt;−&lt;/td&gt;&lt;td style=&quot;color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;&quot;&gt;&lt;div&gt; &lt;/div&gt;&lt;/td&gt;&lt;td colspan=&quot;2&quot;&gt; &lt;/td&gt;&lt;/tr&gt;
&lt;tr&gt;&lt;td class='diff-marker'&gt;−&lt;/td&gt;&lt;td style=&quot;color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;&quot;&gt;&lt;div&gt;&lt;del class=&quot;diffchange diffchange-inline&quot;&gt;Soon after orthotopic transplantation, MK-1775 overexpression was not oncogenic but significantly improved the capability of ERBB2 to kind tumors. Our scientific tests Plk1 inhibitors argue that MK-1775 overexpression and improved PDPK1 duplicate amount are prevalent occurrences in most cancers that potentiate the oncogenic impact of upstream lesions on the PI3K ERBB2/HER2/Neu, PTEN, and PIK3CA ) usually contribute to breast carcinoma development by their ability to regulate the intracellular stage of phosphatidylinositol-3,four,5-triphosphate three-phosphoinositide-dependent kinase 1, a serine threonine kinase known as the master AGC kinase, activates the catalytic area of over twenty other kinases by phosphorylating their T-loops. FISH and CISH A Plk1 inhibitors BAC clone spanning PDPK1 gene was acquired from BACPAC Assets. A green-labeled CEP sixteen probe was utilized for chromosome 16. A situation was regarded to have elevated copy number for PDPK1 if at the very least 25% of cells contained increased or equal to 5 copies. ERBB2 CISH was executed as described.&lt;/del&gt;&lt;/div&gt;&lt;/td&gt;&lt;td colspan=&quot;2&quot;&gt; &lt;/td&gt;&lt;/tr&gt;
&lt;tr&gt;&lt;td class='diff-marker'&gt;−&lt;/td&gt;&lt;td style=&quot;color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;&quot;&gt;&lt;div&gt; &lt;/div&gt;&lt;/td&gt;&lt;td colspan=&quot;2&quot;&gt; &lt;/td&gt;&lt;/tr&gt;
&lt;tr&gt;&lt;td class='diff-marker'&gt;−&lt;/td&gt;&lt;td style=&quot;color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;&quot;&gt;&lt;div&gt;&lt;del class=&quot;diffchange diffchange-inline&quot;&gt;Tissue GSK2118436 Culture Phoenix-ampho Plk1 inhibitors cells for retrovirus production have been supplied by Dr. Gary Nolan, Stanford University. After transfection, the virus was stabilized with FBS and handed by means of a .forty five m filter. Morphogenesis assay carried out as explained for MCF10A. Cells were being fed on Working day 3, 5, and 7. Pics were being taken and cells were harvested on day 16. Immunoblotting Total cell lysates had been utilised in immunoblots. Antibodies were from Cell Signaling apart from MK-1775, MK-1775 or PKB Kinase, -tubulin, PTEN, c-Neu. Migration Assay 8 104 cells in assay media ended up positioned in the higher chambers of eight micron 24-nicely Transwell cell tradition plates and the assay executed as described. AKT RNAi migration MCF10A cells with and with out sble above-expression of MK-1775 have been contaminated with shRNA lentiviral vectors focusing on AKT1 and/or AKT2, or vacant pLKO.&lt;/del&gt;&lt;/div&gt;&lt;/td&gt;&lt;td colspan=&quot;2&quot;&gt; &lt;/td&gt;&lt;/tr&gt;
&lt;tr&gt;&lt;td class='diff-marker'&gt;−&lt;/td&gt;&lt;td style=&quot;color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;&quot;&gt;&lt;div&gt; &lt;/div&gt;&lt;/td&gt;&lt;td colspan=&quot;2&quot;&gt; &lt;/td&gt;&lt;/tr&gt;
&lt;tr&gt;&lt;td class='diff-marker'&gt;−&lt;/td&gt;&lt;td style=&quot;color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;&quot;&gt;&lt;div&gt;&lt;del class=&quot;diffchange diffchange-inline&quot;&gt;Forty-eight hours immediately after infection, Transwell migration assays have been executed. Relative migration of MCF10A cells is expressed as the ratio of the amount of cells that migrated to the reduced area of the membrane over that of handle. Mouse reports Animal processes were done in compliance with Columbia University Institutional Animal Care and Use Committee in Institute of Comparative Medicine.&lt;/del&gt;&lt;/div&gt;&lt;/td&gt;&lt;td colspan=&quot;2&quot;&gt; &lt;/td&gt;&lt;/tr&gt;
&lt;tr&gt;&lt;td class='diff-marker'&gt;−&lt;/td&gt;&lt;td style=&quot;color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;&quot;&gt;&lt;div&gt; &lt;/div&gt;&lt;/td&gt;&lt;td colspan=&quot;2&quot;&gt; &lt;/td&gt;&lt;/tr&gt;
&lt;tr&gt;&lt;td class='diff-marker'&gt;−&lt;/td&gt;&lt;td style=&quot;color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;&quot;&gt;&lt;div&gt;&lt;del class=&quot;diffchange diffchange-inline&quot;&gt;7 week previous SCID/NCr mice were being injected subcutaneously with 1.five 106 cells into inferior mammary excess fat pad. Mice were being monitored each day for common Plk1 inhibitors overall health and tumor growth. Mice were being sacrificed 6 months after injection, or when tumors attained a floor area of one cm2 as measured by caliper. Protein Lysate Array As explained formerly interrogating total MK-1775 and MK-1775 phosphorylated on residue serine 241. MK-1775 shRNA The shRNA lentiviral particles targeting MK-1775, and nontarget shRNA management transduction particles were purchased from Sigma-Aldrich. The shRNA transductions had been performed as for every company s guidance. Two different clones were being employed: TRCN0000039779 : ccggcgaagatgagaagaggttgttctcgagaacaacctcttctcatcttcgtttttg.&lt;/del&gt;&lt;/div&gt;&lt;/td&gt;&lt;td colspan=&quot;2&quot;&gt; &lt;/td&gt;&lt;/tr&gt;
&lt;tr&gt;&lt;td class='diff-marker'&gt;−&lt;/td&gt;&lt;td style=&quot;color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;&quot;&gt;&lt;div&gt; &lt;/div&gt;&lt;/td&gt;&lt;td colspan=&quot;2&quot;&gt; &lt;/td&gt;&lt;/tr&gt;
&lt;tr&gt;&lt;td class='diff-marker'&gt;−&lt;/td&gt;&lt;td style=&quot;color: #222; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;&quot;&gt;&lt;div&gt;&lt;del class=&quot;diffchange diffchange-inline&quot;&gt;TRCN0000039782 : ccggcaaagttctgaaaggtgaaatctcgagatttcacctttcagaactttgtttttg.&lt;/del&gt;&lt;/div&gt;&lt;/td&gt;&lt;td colspan=&quot;2&quot;&gt; &lt;/td&gt;&lt;/tr&gt;
&lt;/table&gt;</summary>
		<author><name>Moderator</name></author>
		
	</entry>
	<entry>
		<id>https://wiki.mininuniver.ru/index.php?title=~Delete_1983&amp;diff=115625&amp;oldid=prev</id>
		<title>Beastblood51: Новая: We present that overall MK-1775 protein and mRNA was in excess of-expressed [http://www.selleckchem.com/products/MK-1775.html MK-1775], [http://www.selleckchem.com/products/dabrafenib-gs...</title>
		<link rel="alternate" type="text/html" href="https://wiki.mininuniver.ru/index.php?title=~Delete_1983&amp;diff=115625&amp;oldid=prev"/>
		<updated>2013-03-30T08:49:05Z</updated>

		<summary type="html">&lt;p&gt;Новая: We present that overall MK-1775 protein and mRNA was in excess of-expressed [http://www.selleckchem.com/products/MK-1775.html MK-1775], [http://www.selleckchem.com/products/dabrafenib-gs...&lt;/p&gt;
&lt;p&gt;&lt;b&gt;Новая страница&lt;/b&gt;&lt;/p&gt;&lt;div&gt;We present that overall MK-1775 protein and mRNA was in excess of-expressed [http://www.selleckchem.com/products/MK-1775.html MK-1775], [http://www.selleckchem.com/products/dabrafenib-gsk2118436.html order Dabrafenib  find out here], [http://www.selleckchem.com/products/Enzastaurin.html purchase Enzastaurin selleckchem]  in a bulk of human breast cancers and that 21% of tumors experienced five or much more copies of the gene encoding MK-1775, PDPK1. In human mammary cells, MK-1775 improved the potential of upstream lesions to signal to AKT, stimulate mobile growth and migration, and rendered cells more resistant to MK-1775 and PI3K inhibition.&lt;br /&gt;
&lt;br /&gt;
Soon after orthotopic transplantation, MK-1775 overexpression was not oncogenic but significantly improved the capability of ERBB2 to kind tumors. Our scientific tests Plk1 inhibitors argue that MK-1775 overexpression and improved PDPK1 duplicate amount are prevalent occurrences in most cancers that potentiate the oncogenic impact of upstream lesions on the PI3K ERBB2/HER2/Neu, PTEN, and PIK3CA ) usually contribute to breast carcinoma development by their ability to regulate the intracellular stage of phosphatidylinositol-3,four,5-triphosphate three-phosphoinositide-dependent kinase 1, a serine threonine kinase known as the master AGC kinase, activates the catalytic area of over twenty other kinases by phosphorylating their T-loops. FISH and CISH A Plk1 inhibitors BAC clone spanning PDPK1 gene was acquired from BACPAC Assets. A green-labeled CEP sixteen probe was utilized for chromosome 16. A situation was regarded to have elevated copy number for PDPK1 if at the very least 25% of cells contained increased or equal to 5 copies. ERBB2 CISH was executed as described.&lt;br /&gt;
&lt;br /&gt;
Tissue GSK2118436 Culture Phoenix-ampho Plk1 inhibitors cells for retrovirus production have been supplied by Dr. Gary Nolan, Stanford University. After transfection, the virus was stabilized with FBS and handed by means of a .forty five m filter. Morphogenesis assay carried out as explained for MCF10A. Cells were being fed on Working day 3, 5, and 7. Pics were being taken and cells were harvested on day 16. Immunoblotting Total cell lysates had been utilised in immunoblots. Antibodies were from Cell Signaling apart from MK-1775, MK-1775 or PKB Kinase, -tubulin, PTEN, c-Neu. Migration Assay 8 104 cells in assay media ended up positioned in the higher chambers of eight micron 24-nicely Transwell cell tradition plates and the assay executed as described. AKT RNAi migration MCF10A cells with and with out sble above-expression of MK-1775 have been contaminated with shRNA lentiviral vectors focusing on AKT1 and/or AKT2, or vacant pLKO.&lt;br /&gt;
&lt;br /&gt;
Forty-eight hours immediately after infection, Transwell migration assays have been executed. Relative migration of MCF10A cells is expressed as the ratio of the amount of cells that migrated to the reduced area of the membrane over that of handle. Mouse reports Animal processes were done in compliance with Columbia University Institutional Animal Care and Use Committee in Institute of Comparative Medicine.&lt;br /&gt;
&lt;br /&gt;
7 week previous SCID/NCr mice were being injected subcutaneously with 1.five 106 cells into inferior mammary excess fat pad. Mice were being monitored each day for common Plk1 inhibitors overall health and tumor growth. Mice were being sacrificed 6 months after injection, or when tumors attained a floor area of one cm2 as measured by caliper. Protein Lysate Array As explained formerly interrogating total MK-1775 and MK-1775 phosphorylated on residue serine 241. MK-1775 shRNA The shRNA lentiviral particles targeting MK-1775, and nontarget shRNA management transduction particles were purchased from Sigma-Aldrich. The shRNA transductions had been performed as for every company s guidance. Two different clones were being employed: TRCN0000039779 : ccggcgaagatgagaagaggttgttctcgagaacaacctcttctcatcttcgtttttg.&lt;br /&gt;
&lt;br /&gt;
TRCN0000039782 : ccggcaaagttctgaaaggtgaaatctcgagatttcacctttcagaactttgtttttg.&lt;/div&gt;</summary>
		<author><name>Beastblood51</name></author>
		
	</entry>
</feed>